ID: 1152649313_1152649323

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1152649313 1152649323
Species Human (GRCh38) Human (GRCh38)
Location 17:81484581-81484603 17:81484624-81484646
Sequence CCTTGGGACCCCTTCGCGCCCTG CACCCCCGCCCCTCCCTGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 83, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!