ID: 1152663164_1152663173

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1152663164 1152663173
Species Human (GRCh38) Human (GRCh38)
Location 17:81552309-81552331 17:81552351-81552373
Sequence CCCGCGGCGCGGCGCCGGCCATC AGTGAGAAGCCCCGGCCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143} {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!