ID: 1152690992_1152691009

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1152690992 1152691009
Species Human (GRCh38) Human (GRCh38)
Location 17:81717585-81717607 17:81717629-81717651
Sequence CCTTGGGCATCTGGCAGTGCCCC CCAGGGCTTTGGGAGCTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 277} {0: 1, 1: 0, 2: 2, 3: 30, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!