ID: 1152691000_1152691007

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1152691000 1152691007
Species Human (GRCh38) Human (GRCh38)
Location 17:81717605-81717627 17:81717628-81717650
Sequence CCCCTGGGGCTCATAAGTGGGGT GCCAGGGCTTTGGGAGCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83} {0: 1, 1: 0, 2: 17, 3: 468, 4: 9420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!