ID: 1152713983_1152713992

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1152713983 1152713992
Species Human (GRCh38) Human (GRCh38)
Location 17:81889498-81889520 17:81889541-81889563
Sequence CCAAGAGCACCTGGGTCTGAGGG TGACACGTGTACCACGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 299} {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!