ID: 1152748509_1152748520

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1152748509 1152748520
Species Human (GRCh38) Human (GRCh38)
Location 17:82051983-82052005 17:82052002-82052024
Sequence CCCGGGCCTCCGCGCCCCCGCGC GCGCCCCCCGCCACTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 19, 3: 105, 4: 675} {0: 1, 1: 0, 2: 3, 3: 26, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!