ID: 1152791698_1152791705

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1152791698 1152791705
Species Human (GRCh38) Human (GRCh38)
Location 17:82283595-82283617 17:82283625-82283647
Sequence CCACCCAGTGAATCGGCAGCCAT TCCCTAGCACCTCCTCCCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 37, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!