ID: 1152791864_1152791867

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152791864 1152791867
Species Human (GRCh38) Human (GRCh38)
Location 17:82284426-82284448 17:82284459-82284481
Sequence CCAGCCTGGGTGACAGAGCAAGA AAAAAAAAAAAAAAAAAAAAAGG
Strand - +
Off-target summary {0: 26457, 1: 73050, 2: 147182, 3: 159645, 4: 143243} {0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!