ID: 1152922755_1152922766

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1152922755 1152922766
Species Human (GRCh38) Human (GRCh38)
Location 17:83073977-83073999 17:83074015-83074037
Sequence CCCTGGGCGGTCCCCGGTTCCCG ACAAGGCCTTGCCTCCTTCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!