ID: 1153022758_1153022762

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1153022758 1153022762
Species Human (GRCh38) Human (GRCh38)
Location 18:646334-646356 18:646383-646405
Sequence CCTTTTTTTTTTTCTAGTTGTAT CATCTACTAAGTTTAGATACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 368, 4: 3540} {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!