ID: 1153085181_1153085184

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1153085181 1153085184
Species Human (GRCh38) Human (GRCh38)
Location 18:1278204-1278226 18:1278224-1278246
Sequence CCAGAACGCTCCAGGCAGATCTT CTTCAGAAGGAAGTCTTGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 22, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!