ID: 1153101844_1153101851

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1153101844 1153101851
Species Human (GRCh38) Human (GRCh38)
Location 18:1480539-1480561 18:1480553-1480575
Sequence CCCACCAGGTCCTGGCCTTGACA GCCTTGACACCTGGGGATTATGG
Strand - +
Off-target summary No data {0: 1, 1: 24, 2: 431, 3: 1609, 4: 2741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!