ID: 1153101844_1153101857

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1153101844 1153101857
Species Human (GRCh38) Human (GRCh38)
Location 18:1480539-1480561 18:1480580-1480602
Sequence CCCACCAGGTCCTGGCCTTGACA TACAATTTGAGATAAGATTTGGG
Strand - +
Off-target summary No data {0: 53, 1: 838, 2: 2688, 3: 10242, 4: 12395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!