ID: 1153142264_1153142267

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1153142264 1153142267
Species Human (GRCh38) Human (GRCh38)
Location 18:1986638-1986660 18:1986660-1986682
Sequence CCCTAGAAGAAAATCTAGGCAAT TATGATTCAGAATATAGGCATGG
Strand - +
Off-target summary {0: 672, 1: 8963, 2: 10369, 3: 3555, 4: 1940} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!