ID: 1153142265_1153142267

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1153142265 1153142267
Species Human (GRCh38) Human (GRCh38)
Location 18:1986639-1986661 18:1986660-1986682
Sequence CCTAGAAGAAAATCTAGGCAATA TATGATTCAGAATATAGGCATGG
Strand - +
Off-target summary {0: 717, 1: 9317, 2: 11016, 3: 4541, 4: 2899} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!