ID: 1153427549_1153427553

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1153427549 1153427553
Species Human (GRCh38) Human (GRCh38)
Location 18:4982712-4982734 18:4982747-4982769
Sequence CCTGCAAAGAGACTTAGATTCCC GCAAGGCTTTAACAGCCCACTGG
Strand - +
Off-target summary {0: 4, 1: 319, 2: 7057, 3: 3330, 4: 1494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!