ID: 1153553251_1153553255

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1153553251 1153553255
Species Human (GRCh38) Human (GRCh38)
Location 18:6284559-6284581 18:6284591-6284613
Sequence CCTTGGAGGGGACGCACTGGCCG GCAGGCTGTTCCCAAGCCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 140, 4: 2965}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!