ID: 1153553251_1153553262

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1153553251 1153553262
Species Human (GRCh38) Human (GRCh38)
Location 18:6284559-6284581 18:6284612-6284634
Sequence CCTTGGAGGGGACGCACTGGCCG GGTCGCTTTTCTTCCACATCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!