ID: 1153585293_1153585295

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1153585293 1153585295
Species Human (GRCh38) Human (GRCh38)
Location 18:6614652-6614674 18:6614681-6614703
Sequence CCATGACCTGGGTGATTTATAAA ACATTTATTTCTTGTAGTTCTGG
Strand - +
Off-target summary No data {0: 4, 1: 33, 2: 291, 3: 1450, 4: 3911}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!