ID: 1153656400_1153656402

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1153656400 1153656402
Species Human (GRCh38) Human (GRCh38)
Location 18:7286611-7286633 18:7286640-7286662
Sequence CCAAGAACAGGGATTGGAGTCAG TTGTAAGTCCCAGAGTCTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 20, 3: 94, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!