ID: 1153837498_1153837503

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1153837498 1153837503
Species Human (GRCh38) Human (GRCh38)
Location 18:8977094-8977116 18:8977119-8977141
Sequence CCAAGGTGGCCGGGTGTGGCCAA GCTTGGTTTTACACATTTTAGGG
Strand - +
Off-target summary No data {0: 82, 1: 758, 2: 1344, 3: 1177, 4: 953}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!