ID: 1153837498_1153837504

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1153837498 1153837504
Species Human (GRCh38) Human (GRCh38)
Location 18:8977094-8977116 18:8977122-8977144
Sequence CCAAGGTGGCCGGGTGTGGCCAA TGGTTTTACACATTTTAGGGAGG
Strand - +
Off-target summary No data {0: 24, 1: 151, 2: 285, 3: 242, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!