ID: 1154146415_1154146418

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1154146415 1154146418
Species Human (GRCh38) Human (GRCh38)
Location 18:11869832-11869854 18:11869873-11869895
Sequence CCAGGAGGCGGAGGTTACAGTAA CACGTCAGTCTGGGCGACAGAGG
Strand - +
Off-target summary {0: 51, 1: 2661, 2: 48075, 3: 164181, 4: 144409} {0: 1, 1: 2, 2: 126, 3: 2724, 4: 8974}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!