ID: 1154173755_1154173763

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1154173755 1154173763
Species Human (GRCh38) Human (GRCh38)
Location 18:12068349-12068371 18:12068389-12068411
Sequence CCCAAGTCAGCTTCTCGCGGGCC GGCCGAACCCTTGCCCCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47} {0: 1, 1: 1, 2: 0, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!