ID: 1154173767_1154173784

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1154173767 1154173784
Species Human (GRCh38) Human (GRCh38)
Location 18:12068402-12068424 18:12068452-12068474
Sequence CCCCTCTTGGCGTACGTGCTGCT CACCTGTCAGGCGGCGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 51} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!