ID: 1154173772_1154173778

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1154173772 1154173778
Species Human (GRCh38) Human (GRCh38)
Location 18:12068425-12068447 18:12068440-12068462
Sequence CCGCGCCGCCGCCGCCGCCGGGG CGCCGGGGCCCACACCTGTCAGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 190, 3: 476, 4: 1498} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!