ID: 1155113255_1155113262

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1155113255 1155113262
Species Human (GRCh38) Human (GRCh38)
Location 18:22737326-22737348 18:22737361-22737383
Sequence CCATATGCAGAAGACTGAAACCC CTCCGTGGGAAGCAGTGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 366, 3: 4769, 4: 7031} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!