ID: 1155203968_1155203972

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1155203968 1155203972
Species Human (GRCh38) Human (GRCh38)
Location 18:23541433-23541455 18:23541459-23541481
Sequence CCTGTCGGGGAGAGAAGGGCTCT TCACTTCTGTTTACAGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 96} {0: 1, 1: 0, 2: 2, 3: 8, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!