ID: 1155436674_1155436678

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1155436674 1155436678
Species Human (GRCh38) Human (GRCh38)
Location 18:25819861-25819883 18:25819897-25819919
Sequence CCCCACTAGGAAAGAGCAAGCAG GTTCCCTCCCAAGAGCTCTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!