ID: 1155467222_1155467232

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1155467222 1155467232
Species Human (GRCh38) Human (GRCh38)
Location 18:26150445-26150467 18:26150474-26150496
Sequence CCCCCGCCGCAGCCTCCCAAGTA ACTACAGGCATGTGCCAGCATGG
Strand - +
Off-target summary {0: 2, 1: 60, 2: 2338, 3: 4877, 4: 7471} {0: 2, 1: 79, 2: 497, 3: 1240, 4: 2604}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!