ID: 1155558571_1155558575

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1155558571 1155558575
Species Human (GRCh38) Human (GRCh38)
Location 18:27049968-27049990 18:27049996-27050018
Sequence CCTCAACAAAGTGCAGGCTCCGG CAAATCAAGTTTTAGAAGTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!