ID: 1155923557_1155923565

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1155923557 1155923565
Species Human (GRCh38) Human (GRCh38)
Location 18:31629976-31629998 18:31630013-31630035
Sequence CCAGCAAAAAAAAAGGAAGGAGG GTGGAGAAGGAGAAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 99, 4: 890} {0: 1, 1: 0, 2: 20, 3: 285, 4: 2100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!