ID: 1156190274_1156190277

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1156190274 1156190277
Species Human (GRCh38) Human (GRCh38)
Location 18:34711188-34711210 18:34711212-34711234
Sequence CCCAGAGCGCAGACGCCTTCTCA GCGTTGTTTACATATCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79} {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!