ID: 1156317319_1156317322

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1156317319 1156317322
Species Human (GRCh38) Human (GRCh38)
Location 18:35982264-35982286 18:35982283-35982305
Sequence CCAACTTGAGATTTTTTTTAACA AACATTATGATGGGTTTACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 57, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!