ID: 1156517183_1156517194

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1156517183 1156517194
Species Human (GRCh38) Human (GRCh38)
Location 18:37690311-37690333 18:37690341-37690363
Sequence CCATGTGTGTTACTGCCCCTGAA CAGTAGGACAAGATGTGGAGGGG
Strand - +
Off-target summary {0: 23, 1: 114, 2: 233, 3: 362, 4: 519} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!