ID: 1156863433_1156863436

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1156863433 1156863436
Species Human (GRCh38) Human (GRCh38)
Location 18:41864286-41864308 18:41864336-41864358
Sequence CCTTGGCCCAGTAAGATGTGATT ATTTTTATCAGAGCTGCGTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 1, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!