ID: 1157037281_1157037287

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1157037281 1157037287
Species Human (GRCh38) Human (GRCh38)
Location 18:43990017-43990039 18:43990034-43990056
Sequence CCTTTCATATGGTGGGGGGATGG GGATGGGGAGGGATAATATTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!