ID: 1157037281_1157037289

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1157037281 1157037289
Species Human (GRCh38) Human (GRCh38)
Location 18:43990017-43990039 18:43990066-43990088
Sequence CCTTTCATATGGTGGGGGGATGG TAATGTAAATGACGAGTTAATGG
Strand - +
Off-target summary No data {0: 3401, 1: 4646, 2: 2884, 3: 2471, 4: 9875}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!