ID: 1157037281_1157037290

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1157037281 1157037290
Species Human (GRCh38) Human (GRCh38)
Location 18:43990017-43990039 18:43990067-43990089
Sequence CCTTTCATATGGTGGGGGGATGG AATGTAAATGACGAGTTAATGGG
Strand - +
Off-target summary No data {0: 3240, 1: 4686, 2: 3070, 3: 8538, 4: 9290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!