ID: 1157275636_1157275645

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1157275636 1157275645
Species Human (GRCh38) Human (GRCh38)
Location 18:46309510-46309532 18:46309556-46309578
Sequence CCTGGTAGTTTTTGTATTTTTAG GGCCAGGCTGGTCTCCATGTTGG
Strand - +
Off-target summary {0: 34, 1: 3358, 2: 93800, 3: 74103, 4: 61634} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!