ID: 1157303667_1157303672

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1157303667 1157303672
Species Human (GRCh38) Human (GRCh38)
Location 18:46500101-46500123 18:46500130-46500152
Sequence CCCTCCTCTTCCTTCTTTTCCAT ACCTCAAATGTTGAAATTCTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 42, 3: 409, 4: 2934} {0: 1, 1: 0, 2: 1, 3: 22, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!