ID: 1157383809_1157383822

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1157383809 1157383822
Species Human (GRCh38) Human (GRCh38)
Location 18:47246648-47246670 18:47246677-47246699
Sequence CCTTCTGGGGGGCCAGGGGCGGC GGCGGGGGCAGGTCCGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 896} {0: 1, 1: 0, 2: 4, 3: 34, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!