ID: 1157507519_1157507527

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1157507519 1157507527
Species Human (GRCh38) Human (GRCh38)
Location 18:48239124-48239146 18:48239154-48239176
Sequence CCTGAGAACCAACCCTCATCCCC GCTGCAGCAAGCCCCACTCAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 39, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!