ID: 1157587160_1157587165

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1157587160 1157587165
Species Human (GRCh38) Human (GRCh38)
Location 18:48810199-48810221 18:48810231-48810253
Sequence CCCATATCAGTCGGGATAGCCAC GCTCAATATATTGTCACATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25} {0: 1, 1: 0, 2: 1, 3: 6, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!