ID: 1157587160_1157587166

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1157587160 1157587166
Species Human (GRCh38) Human (GRCh38)
Location 18:48810199-48810221 18:48810238-48810260
Sequence CCCATATCAGTCGGGATAGCCAC ATATTGTCACATGTGGATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25} {0: 1, 1: 0, 2: 3, 3: 51, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!