ID: 1158251987_1158251990

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1158251987 1158251990
Species Human (GRCh38) Human (GRCh38)
Location 18:55499501-55499523 18:55499543-55499565
Sequence CCTAGCTCCATCTGTTTATGTAG GACTGTACATTAGAATCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172} {0: 1, 1: 5, 2: 71, 3: 328, 4: 1105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!