ID: 1158251987_1158251992

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1158251987 1158251992
Species Human (GRCh38) Human (GRCh38)
Location 18:55499501-55499523 18:55499545-55499567
Sequence CCTAGCTCCATCTGTTTATGTAG CTGTACATTAGAATCAACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172} {0: 2, 1: 24, 2: 156, 3: 539, 4: 1358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!