ID: 1158318517_1158318523

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1158318517 1158318523
Species Human (GRCh38) Human (GRCh38)
Location 18:56238029-56238051 18:56238065-56238087
Sequence CCAGCTTCAACCATCTCCCTGAC CTCTAGCTTCCGATTGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 444, 4: 7669} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!