ID: 1158448179_1158448180

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1158448179 1158448180
Species Human (GRCh38) Human (GRCh38)
Location 18:57539471-57539493 18:57539513-57539535
Sequence CCATCACTGTTCTAGAAAATAAT AAACATAAAAGTAAGCTGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!