ID: 1158512751_1158512763

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1158512751 1158512763
Species Human (GRCh38) Human (GRCh38)
Location 18:58106150-58106172 18:58106194-58106216
Sequence CCCTGTGTAGGGACATCCGTGCT CCCAAATCAACTGTCAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59} {0: 1, 1: 0, 2: 1, 3: 10, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!